How do you tell the difference between a computer scientist and an aspiring music artist?

Ask them what 'unsigned' means.

Previous Random Joke Next
Difference Jokes More Difference Jokes

What's the difference between a feminist and a gun?

Some people are against shooting guns.

What's the difference between a chickpea and a garabonzo bean?

I don't have a garabonzo bean in my garage because that's where I get pee'd on so there is tarps everywhere.

Tell Jokes More Tell Jokes

Why can't you tell knock knock jokes about freedom?

Because freedom rings

How can you tell when you are talking to an extroverted engineer?

They look at your feet instead of theirs.

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

How's life?

she asked. "Oh same as usual" he replied "boring."

Computer Scientist Jokes More Computer Scientist Jokes

Why do Computer Scientists always mix up Halloween and Christmas?

Because OCT 31 = DEC 25!

How do you tell the difference between a computer scientist and an aspiring music artist?

Ask them what 'unsigned' means.

Aspire Jokes More Aspire Jokes

How many aspiring actresses does it take to screw in a lightbulb?

I don't know - normally they screw in the casting director's hot tub

How do you tell the difference between a computer scientist and an aspiring music artist?

Ask them what 'unsigned' means.