What is the main reason people are voting for Brexit?

When asked if they want to be economically joined with Greece, all they can say is "eeeeuuuuuuu"

Previous Random Joke Next
Want Jokes More Want Jokes

Why do Republicans use rulers?

They want everything to be straight.

What did you do before you were married sir?

A: *with teary eyes* whatever the hell i wanted to do ...

People Jokes More People Jokes

What is the difference between a English actuary and a Sicilian actuary?

An English actuary can tell you how many people are going to die next year. A Sicilian actuary can give you their names...

Why are people who suffers from insomnia so excited at the moment?

They only have to sleep 3 more times until Christmas

Join Jokes More Join Jokes

Why did the King's Justice join Run DMC?

Cuz he be Ilyn.

Why did King Kong join the army?

To learn about gorilla warfare.

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Why did the college student ask for a refund on his student loan?

Because his *degree* didn't work!

Vote Jokes More Vote Jokes

What walks on two legs, but can't move forward?

Americans who voted for Hillary

Which UK party will the sleeping pigs be voting for in May?

The Lay-Boar Party.

Greece Jokes More Greece Jokes

What is the main reason people are voting for Brexit?

When asked if they want to be economically joined with Greece, all they can say is "eeeeuuuuuuu"

Why did the boy want to see a thunder storm in Greece?

Because Greece lightening

Brexit Jokes More Brexit Jokes

What do you call the divorce between Brad Pitt and Angelina Jolie?

a Brexit

What's the difference between a feminist and Brexit?

Brexit has actually affected society.