What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

Previous Random Joke Next
Drink Jokes More Drink Jokes

Why do Communists drink herbal tea?

Because proper-tea is theft.

When I get a prescription for drugs, I don't ask, Will it work?

Are there any side effects ' No, it's Can I drink with these '

Leave Jokes More Leave Jokes

What's better than having a 'Brexit' vote about Britain leaving the EU?

Not being British.

Why couldn't the NSA whistleblower leave Moscow?

He got snowed in.

Girl Jokes More Girl Jokes

What's the Difference between a Girl and a Woman?

Prison

Why did the girl reject iron oxide?

Because it was FeO

Order Jokes More Order Jokes

Why are people always having their pizzas delivered?

Just order them without liver."

Why are you being so distant?

Me: Why didn't you order a side of guacamole

Bartender Jokes More Bartender Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender